Thursday, April 23, 2015

Week 2 Protein Synthesis: Post ( DNA Strand)

By J Grajeda

Here is my DNA strand, go ahead feel free to decode!!! Thanks

ATTGTCATAAGCATTGGTTAGCACCGGCATACCCATCGCCG

Thursday, April 16, 2015

Week#1 Darwin's Work Influences


April 16, 2015  
  1. There were several scientists, writers, and friends that had a significant influenced on Charles Darwin's work, but in 1838 after reading an essay "on the principle of population" by Thomas Malthus, this would have a significant positive impact on Charles Darwin future work.
  2. Thomas Malthus contribution to the scientific community was his writings "Thomas Malthus wrote essays about populations and carrying capacities for the environment. Malthus was an economist and his ideas about overpopulation, disease, and the struggle to survive influenced Darwin". http://www.allaboutscience.org/thomas-malthus-faq.htm
  3.   Third point from top would be in-line with Charles Darwin's own principles, "they recognized the important fact that when population size is limited by resource, availability, there is constant competition".    
  4. Yes, in 1844 Darwin had already written a brief summary of his natural selection hypothesis but he felt that he didn't had enough data to support it his publishing. Another impediment that hold him back was his wife Emma who happen to have a very strong religious believes. 
  5. As a member of the established order he feared that many of his inner circle friends and family members would be persecuted or single out.