Week 7: Language Blog

By: J Grajeda

Part1:

·      Prior to conducting my language experiment, I shared the guidelines with my team members, so we all understood a baseline to work from. I wanted to make our interaction as natural as possible; in other words, our conversation was about how things went in the prior days, school, work, and general family events. As we started communicating with each other, we encountered difficulties, there were times where there were multiple persons talking or repeated the same questions, there were multiple delays due to my inability to respond clearly or promptly, wife and kids had to make adjustments to their way of communicating, multiple pauses, a lot of use of hands and body language to answer or provide input. It felt like I was forcing them to make changes to fit my needs in order to fit in and be part of their world.

·      I’m not exactly sure who was in control in our conversation, there were times when I felt that I was in command, but most of the time my partners had to adjust their vocal approach to insure we understood our conversation. Most of our topics were initiated by my team, leading with lots of short questions that I would respond with hand signals or body movements. My partner (wife) definitely had the advantage from a power standpoint, she had to adjust many times for us to have a meaningful conversation, but if we rolled the clock five million years ago, I would probably be left out of many critical phases of daily life events, not to mention if there were any real time emergencies, with the disadvantage of not being able to speak it would have been a crucial element to own survival.

·      When I think about having two different cultures, one not being able to speak and the other culture with the ability to verbally communicate, there is no doubt in my mind that the culture that is able to effectively communicate complex issues, such as safety, health, and education would have the advantage. Look at our indigenous groups around the globe, especially in America, North and South, they seem to be less fortunate, they’re faced with extreme levels of discrimination, poverty, poor nutrition, serious health problems and unequal opportunities to prosper and thrive as a population. All of these conditions are linked to their inability to communicate and the disadvantages of not speaking a language.  

Week 7: Language Blog

Part2:

·      This experiment was less difficult from a comprehentional standpoint,  we were able to quickly adjust and carry normal conversations, but my partners felt ackward due to lack of body language, they also mentioned limited interest and miminum physical emotion.

·      Having the ability to verbally communicate and interact with our body, it enhances the delivery and makes others feel more receptive, it also helps to better understand the information being shared.

·      It provided an advantage to those that had ability to read body language, they were the leaders, adjusting quickly to invironmental changes, getting first hand on available resources and finally better odds of reproducing.

·      I think most people are able to read body language of some sort.

In an emergency setting at a hospital, your friend is having open heart surgery, the Doctor comes out of ER with his head down, arms crossed and  exhausted from a succesful procedure. This scenario would help this pearson by not making wrong preconception.

Week 5: Piltdown Hoax Blog

Antro 101 – Online

By: J Grajeda

5/12/15

11.    The beginning of the Piltdown Hoax started in the year 1912, in southeast England, near the small village of Piltdown, after a laborer uncovered what appeared to be an ancient skull. After passing the skull to Charles Dawson, this would start a series of fossil discoveries at Piltdown.  After additional findings and specially after locating a large jawbone, what seem to be the missing piece of the skull, soon after Charles invited over Arthur Woodward a leading geologist and paleontologist Father Teilhard de Chardin. In December 1912 they officially announce fossil findings from the Royal Society Meeting Room. By the 1920’s new fossil discoveries surfaced from Asia and Africa but fossils didn’t jived with Dawson’s findings, suspicion and doubts started, but working with Woodward’s and due to his prestige helped erased any doubts, although he specialized on fish fossils and not human evolution. After World War II and the introduction of newer technology a fluorine test was conducted to identify bone age, this confirmed that the fossils were forged. The jawbone was less than 100 years old and belonged to a female Orangutan.

22.     It was evident especially in Mr. Dawson’s case that jealousy, greed, and pride lead to famous hoax. Lost of credibility at different levels of society, scientist and general population.   

33.     Full scale analysis conducted in 1953 confirmed the hoax, fossils were stained and cut using a file and steel knifes

44.     I think the human factor needs to remain in science; it’s an intricate piece to fact-finding, objectivity and data analysis.

55.     A human being will always be measured by its core values, in this example integrity, and honesty was left aside taken over by greed and selfishness.

Week 4 Comparative Primate Blog

By: J Grajeda

Wednesday, May 6, 2015

Comparative Primate Blog:

Sifaka (Prosimians/Strepsirhini representative)

·       The species has an extremely limited distribution, they are confined to a number of discontinuous forest fragments between the Manambato and Loky Rivers in northeast of Madagascar.

·       Sifakas are predominantly arboreal and diurnal although sometimes active before dawn and after dusk during the rainy season. They eat a variety of unripe fruit, sees, shoots, and leaves. When food is scarce during the dry season, they will eat bark.

·       Sifakas has one of the smallest ranges and documented population sizes of any lemur. No part of the species’ range is protected. Isolated patches of forests which remain are under pressure from burn agriculture and logging. Mining for gold has led to further habitat loss, and miners hunt them for food. They are classified as critically endangered species.

Spider Monkey (New World Monkey/Platyrrhini representative)

·       New world, Spider Monkeys are found in tropical rain forests in Central and South America, from southern Mexico to Brazil. They live in wet and dense tropical rainforests. Predation is present by indigenous people who hunt them for food and pet trade; in addition logging and deforestation continues to reduce habitat and resources, main predators are jaguars, pumas, and large snakes. 

·       Omnivore; their diet includes nuts, fruits, leaves, bird eggs, honey, insect larvae, and spiders.

Olive Baboon (Old World Monkey/Cercopithecidae representative)

·       Olive baboons live in a variety of habitat, open grassland near wooded areas, they also found in moist evergreen forests and near human habitation and cultivation. In Ethiopia baboons can be found near valley bottoms, utilizing all habitats found from the valley floor to the plateau. The rainy season is from July to September and the dry season extends from mid-September to June with an average of 5.5 feet of rain. Daytime temperatures reach 35 Celsius and remain throughout the year.

·       Olive baboons consume a wide range of foods, they have ability to extract food and nutrients from almost strata of the environment. Baboons are omnivores and consume roots, tubers, corns, fruits, leaves, flowers, buds, seeds, bark, birds, bird eggs and vertebrates.

·       Known predators of baboons include lions, leopards, wild dogs, hyenas, chimpanzees, crocodiles and raptors which are more serious threat juveniles and infants.

Lars Gibbon (Lesser ape/Hylobatidae representative)

·       Lar Gibbons are mainly found in Southeast Asia, Indonesia, Malaysia, Myanmar and Thailand. For the most part Gibbons are found in lowland forest, mixed deciduous bamboo forest, seasonal evergreen rainforest. In Thailand three seasons are experienced, cool season is from November to February, hot season is from March thru May and wet season from June thru October. Annual rainfall averages 78” to 118’’ most falling in June thru September. Temperatures average between 25 and 30 Celsius.   

·       Gibbons diet includes a variety of fruits, figs, berries, liana fruits, vine shoots, young leaves, and insects including mantids, wasps and birds’ eggs. Food competition exist with other animals, including pigtail macaques, and dusky leaf monkeys.

·       Threat predation exist to adult and infant gibbons by leopards, marbled cats, Asian golden cats, and hawk eagles.

Chimpanzee (Great ape/Hominidae representative)

·       Chimpanzees our closets living relative, they share 98.6% of our DNA.

·       Chimpanzees can be found in many regions of west and central Africa as well as Asia, China, Laos, Indonesia, and Cambodia. Climate varies depending on the region, but they are generally found in rain forest and wet savannas.

·        They feed on fruits, leaves, buds, blossoms, berries, seeds, their diet consist of 80different plant foods.

·       Chimpanzees are steadily decreasing; wilderness areas critical to their survival are disappearing at an alarming rate mainly due to deforestation, farming and other activities. Another factor has been recent Ebola hemorrhagic fever, threaten to decimate chimpanzee populations in Republic of Congo and Gabon.

While performing my research on all five different primates, most groups shared common behaviors such as living in small, medium and large groups, protecting themselves from predators and other dangers. They were competing for resources and seem to have a hierarchy status.

Week 2 Protein Synthesis: Post ( DNA Strand)

By J Grajeda

Here is my DNA strand, go ahead feel free to decode!!! Thanks

ATTGTCATAAGCATTGGTTAGCACCGGCATACCCATCGCCG

Week#1 Darwin's Work Influences

April 16, 2015  

1. There were several scientists, writers, and friends that had a significant influenced on Charles Darwin's work, but in 1838 after reading an essay "on the principle of population" by Thomas Malthus, this would have a significant positive impact on Charles Darwin future work.
2. Thomas Malthus contribution to the scientific community was his writings "Thomas Malthus wrote essays about populations and carrying capacities for the environment. Malthus was an economist and his ideas about overpopulation, disease, and the struggle to survive influenced Darwin". http://www.allaboutscience.org/thomas-malthus-faq.htm
3.   Third point from top would be in-line with Charles Darwin's own principles, "they recognized the important fact that when population size is limited by resource, availability, there is constant competition".    
4. Yes, in 1844 Darwin had already written a brief summary of his natural selection hypothesis but he felt that he didn't had enough data to support it his publishing. Another impediment that hold him back was his wife Emma who happen to have a very strong religious believes. 
5. As a member of the established order he feared that many of his inner circle friends and family members would be persecuted or single out.